EST 1671599 is a singleton


Sequence

>1671599 (1 EST) Length=122 TTATCTAACAGTCAAGCTGACCAACTCCTACAATTAGTACAAAAGCATTTTCCCGATGGTGTTCATCGAAGCTAAATGAC TAATTCCACTGGTACATTAGACAACTATGAAGTATCTTGATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1671599: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16715993096903AA938792SMTBADA000581SKSchistosoma Lambda Zap II


Date: 22:12:46 on Fri 17 Nov 117.