EST 1671600 is a singleton


Sequence

>1671600 (1 EST) Length=112 AATGCTTCTATTAAAAATTACAAATTAATGTAATCATTAAAATGAATCCAAAAATTGAACAATTACGTAATCTATCCGTA TTATTATTACCATTAGTTTATTTTAAGAACGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1671600: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16716003096904AA938793SMTBADA000584SKSchistosoma Lambda Zap II


Date: 16:3:20 on Tue 21 Nov 117.