EST 1671618 is a singleton


Sequence

>1671618 (1 EST) Length=139 TACTTACTTTCGCCTGTTCCATCACGTGAAGGAGCATAGGCCGCCTACCAGTATTCTCCATCCAACTCTAATTGAATCAT GTAAGTATTGTTTATTGTTATGATGAGTGATACTTGGATTATGAGTGTATATTAACCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1671618: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16716183098705AA938806SMTBADA000221SKSchistosoma Lambda Zap II


Date: 12:10:50 on Mon 20 Nov 117.