EST 1671623 is a singleton


Sequence

>1671623 (1 EST) Length=181 ATGGCAACAACTCACAGTTGATGTCTGGTGCTTTGGAAACTAAGCTGCGTGAAGATCTGGAACGATTAAAGAGGATAAGA TCCCATCGGGTATACGTCACTATTGGGGATTCGGAGTTCCGGGTCACACACAGACACTGGACGACGTGACGACAGTCGGT GAATCTCGAGATGGATTTGCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1671623: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16716233098710AA938811SMTBADA000238SKSchistosoma Lambda Zap II


Date: 2:16:56 on Wed 22 Nov 117.