EST 1671626 is a singleton


Sequence

>1671626 (1 EST) Length=170 CCCTGACAGAGGCTATATACCGTGGCCATGTGATAGCATTTCGCAGAGCGGAGGGTGGCACCTCCCCACTCTCGGACGTA TCAGGGCAAGTTCAACCTCGGCATTAATACTTAAAATTTTATTTCGTGAATCTCTTAAAAATTGCAGTCTAATTTCCATA TATGGAGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1671626: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16716263098713AA938814SMTBADA000250SKSchistosoma Lambda Zap II


Date: 18:22:9 on Fri 17 Nov 117.