EST 1671627 is a singleton


Sequence

>1671627 (1 EST) Length=181 ATATAAAATTCGTTGTAAAGAGATCCGTTCTCTGAACTTCGTGTTTTTGATCTTAAATCTTATTTTATTTCTCTTATCTT TCGACATTGTAGCAATACGGGTTGACATTGAGGACGCAAACACTTAAAAAGGACACGACGGCAGCGAACAACAGGAGAAG GGCAGCGCCGGGGCGAGAGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1671627: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16716273098714AA938815SMTBADA000256SKSchistosoma Lambda Zap II


Date: 4:11:39 on Wed 22 Nov 117.