EST 1688632 is a singleton


Sequence

>1688632 (1 EST) Length=158 CTGAGAATTTTTATCTTAACATGTTTGTTTGATTACAATAATGGTTGTTTTATTTTGTAAATACTCGTTTAAAACGCGAA CGAACAGATCAAGAGGAGCGAATCGAATGATCTATCAATCTTTCTATTTAAGTATATATGTAGGTAAACGAATAAACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1688632: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16886323115402AA952306SMTBADA000586SKSchistosoma Lambda Zap II


Date: 4:11:50 on Wed 22 Nov 117.