EST 1688643 is a singleton


Sequence

>1688643 (1 EST) Length=270 GCTCCGAGGCCAAGAATTCGGCACGAGGGCGGGACACCAACACGCCATCAGAAAATTCGTCGCGGTGGTTCATTGGCCAG CCGCAGCAGCAGCGTCGCCCCCTCTCCTTCCGTGCGCAGCTGGAGCCACCCGCGGTCAACACGTGGAAGCAACAGCGAAA TGCTGAGACGGCATAATGATGTGATTGGAAAGCAGCGTAACAATACTTCCGCCACGACGGTGTCCGCAAAACATCAGTAC TTAGTGAAGGCGGCGAATACAGTGCATCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1688643: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16886433115413AA952317TENS1251T. cruzi epimastigote normalized cDNA Library


Date: 14:32:11 on Fri 17 Nov 117.