EST 1688651 is a singleton


Sequence

>1688651 (1 EST) Length=296 TTTTANACACGGCTTTTGNCGGGCNCNCAGCCCTCAAAAGGCACCCCANTTTATTCATATGGATTGGGTTCATTGAANAA TCCTTTNNAGGGGGAAAATATGAAGTNTCGGCTGCTGTGCACACCGGAGACAAANAAATTTCCACTGGTGGACCCCTTTT TTTTTTTGTGAAGTCAAATCCANTGACNCTGGTTGGGCTGCAGATGACNACGGCGGGTGCGCACCACACCATACCCAGCA CTGTGAGGCTGTTCAATGAACNCCTGGCGGAATATTTTGATGGTTGGGAGGAATTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1688651: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16886513115421AA952325TENS1261T. cruzi epimastigote normalized cDNA Library


Date: 10:40:43 on Tue 21 Nov 117.