EST 1688677 is a singleton


Sequence

>1688677 (1 EST) Length=282 GGCGGANGCCCGGATTCTCNTCNAGCATGCTCGTGTGGAGGCGCAAAATCACCGTTTCACCTATGATGAGCCAATGCGCG TTGAGTCNTGTGCATTGGCCACCTGCNATTTATCTGTTCGATTCGGTGAAAGTGGGGGACGCAAGAAGCTGATGTCCAGA CCATTTGGCGTTTCTCTTCTTATTGCCGGTGTCNATGAAAACGGTCCACAGCTCTGGCAAACAGACCCTAGCGGCACCTA CACACGTTACGACGCTCANNCNATTGGTGCTGGTGCCGAATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1688677: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16886773115447AA952351TENS1289T. cruzi epimastigote normalized cDNA Library


Date: 21:19:32 on Fri 24 Nov 117.