EST 1688686 is a singleton


Sequence

>1688686 (1 EST) Length=290 GNCNATTGGGAAAAGTTGTTGTTAGTANTGTTAGTACTAGTAATAGTAATAGTAATAATAATATTGCTGCCGCGTATACC CATAANTTAATTGAAGGAATATGAATAGGGAGGCATTGACGAAAAATGAAAAGATCACCTACTCTCTTGGTTTTGTGGGG CTATTGATCTTTACAGGCATCACCGCGGGTCTTCAGGTAGCGTTGTTTTCTATGGACCGCCTGTTTCTTCGAATCCTCAC AACAACGGGATCACTACGGGAACGGCGGCAGGCCAAACGTCTATTGGGTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1688686: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16886863115456AA952360TENS1298T. cruzi epimastigote normalized cDNA Library


Date: 13:59:28 on Mon 20 Nov 117.