EST 1688689 is a singleton


Sequence

>1688689 (1 EST) Length=296 GCTTCTGGCTTCCNAATTCANAAAGTTGATGACTTAAATTACATATGTGGAGCGCATTGCAGCAGTGTCTTTGCAGGCNA NACATTTCGCAATTTTTGCCTTTCTTTTCTTGCTTTCTCCGCGGGTGGCTTTTCGTCTTATGGGGTATCTNGGGGAAAAN TCGGTGGTGATTTGGACTCACATGATCAATGACATTGACCTTGGAAAGGTCACTGAACGAGCGTTACCGCAAGATGCCAT TGAGTACTGGGGCCTACACAAGTTGAAATACACAAGGGCCTCCGCCGCGGATGTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1688689: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16886893115459AA952363TENS1301T. cruzi epimastigote normalized cDNA Library


Date: 6:35:45 on Thu 23 Nov 117.