EST 1688703 is a singleton


Sequence

>1688703 (1 EST) Length=290 GNATCGTTCAAAGCTCCAGGNAAGGAATATCAGCAGATAGTCCATGCTCACATCTTGCGGCTGCACACGCGGCGTTGGTG CCACTGTTTCGCATTGCANACTACTACGAAACAGAATTGGCAAGTGTCACCTCGGCGGANANTTATCAAAACATATTGGG AGTCATCCGGCGTGCGGCACGGGAGCAAACGGGGTCTATCCCANCTGTGAAAAACCATTCACCTACGTCGGTCCCTGCCA NATCAGCTGGAACTGCACCATGGAGGCCTCGGGAGATTCTTTACGTCTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1688703: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16887033115473AA952377TENS1315T. cruzi epimastigote normalized cDNA Library


Date: 18:44:5 on Thu 23 Nov 117.