EST 1688708 is a singleton


Sequence

>1688708 (1 EST) Length=291 CGCAGGNCCCNTTATCGCNNCGGTAAACGGTTTCGCACTCGGTGGCGGCTGTGANTTGGCGATGTCTNGCGACATTGTTG TTGCCAGCGAAAAGGCCATCTTTGGGCAACCCGANATCAAAATTGGAACAATTCCGGGCGCGGGTGGGACGCAGCGACTC ACACGACTCATTGGTNAGAGCAAAGCAATGGAATGGATTCTTACAGGTGAGCAATACACGGCCGANGANGCTGAACGCNC CGGGTTGGTTTCACGCGTCNTTAGGCATGANGAACTTCTTCCAACGGTCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1688708: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16887083115478AA952382TENS1320T. cruzi epimastigote normalized cDNA Library


Date: 11:10:46 on Sun 19 Nov 117.