EST 1688709 is a singleton


Sequence

>1688709 (1 EST) Length=271 CTGACGCGGNCCGACATCCGCAAGCGGTGGGAGCGNCGTCCCGACGCGGCTTATTGTGGCGCTGCCGCCGCCGTTTCGGT GGGCACGTGACCCGCAACTCGGCACGCACCTGAGCTTCGTGCCTGTGTCGACGGCGCAACCGATTGGGTTCGGCGGTCCG TGGGGAGCGATGCTGAGCAACGCGACGTGGGTGCGCAACGCGACNAATCCGTCCACCGTCGTGGAGCTGGCTGTGCCCGT GCACCGCGGTTACTACATTGCTGCCGACNAN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1688709: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16887093115479AA952383TENS1321T. cruzi epimastigote normalized cDNA Library


Date: 11:59:33 on Thu 23 Nov 117.