EST 1688716 is a singleton


Sequence

>1688716 (1 EST) Length=296 GGCACNAGGCACNGGTGAAAATTTTGTAAACACCATATGCGCAGGTGCTTGCATTTGCCTGTGAGGCCCGTATTGCCATT ATGGAAAAAAAACCGGGATNTGCTGTGCTTCTTTGGGCGTTTCTGCGGAGAAAANACCGGGGTAATAAATGCATCCATAT CAAATTTGCCTGGGACAGAAAATACAGAGACTTTCTCATCAAAAATTGAGGCATACNAAAGGCTTCAGGAACAGTTTCGA GGGCTGTCAGAGGATGATCAAANACTTATTTTTGACGCCTTGCAACATCCTGAGCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1688716: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16887163115486AA952390TENS1328T. cruzi epimastigote normalized cDNA Library


Date: 11:9:23 on Sun 19 Nov 117.