EST 1688728 is a singleton


Sequence

>1688728 (1 EST) Length=287 AAAGGCNCNAGGTTGACCGAAANAAAANAAGGCTAANCTCTAATCGCTACCGTGAAATTCGAAGGCTCTGAAAGGACCAA CAACGGCACACACACATATTTATATGCTCTCACGTGCTATTATTGCTGTCAAGGCACCCCGTACACACAACCGTCGCCGC GTGACCGGATGCGGCGGTGTAATGAGGGAAGGAAAAAANAGTGAGCGGCANAGGCCCACCATGTCCCGGCATGTGTGTGC TTCCGCGGTGCTGCTTCTCCTTGTCGTGATGGTGATGTGCTGCGTCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 1688728: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16887283115498AA952402TENS1344T. cruzi epimastigote normalized cDNA Library


Date: 17:47:46 on Mon 20 Nov 117.