EST 1688734 is a singleton


Sequence

>1688734 (1 EST) Length=294 TNTTTGCAAAAGCNTGATAANGAGTNCANTGATGTCTGCTCCGACATACTGGAACTTATCNAANAGCACCTCTTACCCAA TGCAAGCACNGAGGAGACAAAGGTTTACTACCTCAAGATGAAGGGTGATTACCACCGCTACTACGCCGAGATTGAGACAA ACNCGGAGGAGCAGAANAACAAGGCACTTGAGGCGTNCACGCNGGCAATGCAGTACAACTCCTCGTTGAAGCCTACGAGC CCAATTCGGCTTGGCCTCGCACTCAACTTCTCCGTCTTCTACTATGAGATCCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1688734: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16887343115504AA952408TENS1352T. cruzi epimastigote normalized cDNA Library


Date: 19:23:52 on Sun 19 Nov 117.