EST 1688743 is a singleton


Sequence

>1688743 (1 EST) Length=288 CTCCGGCACTTCCACGAGCAGGACAGCACCGGAGCACNAAGGGGGCGTCCCCGTGAATATGACAATCTGGCTGCATCCAC CCCGTTCCGGTGCACNACCTGTGGATTCGTTGCCCACACAAAAGCGAGAATGACATCCCATTCACGCGCACACGCACGCT CCGGAACAAAGCCGGAGCCGGCACCAGGGACCACAGCACTCCATGGATGTCCTTACTTCGACAGGGGGCGGGCAATGCCG GGGCCCCGGCCTGCCACACCCGGCACACTCTCTCCGACGGTGAGAGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1688743: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16887433115513AA952417TENS1334T. cruzi epimastigote normalized cDNA Library


Date: 22:29:48 on Tue 21 Nov 117.