EST 1688744 is a singleton


Sequence

>1688744 (1 EST) Length=299 ANGTGATNGCCCTGGGTTGGAAAGGAATATTTACGTATATATATATATACATATACATATATGGCGATGCCAGNATTGCA ACAANTTCTTGCTGCATCGGGTGGGGCTCATGGTGCTCGGGCATACCGCAAATTAACGGGTGCCGGGGTTTTTTTTCANC CGTACCTGCTGCGGGCAGTGGAGGAAAAAANAGGGATGTGGTCCTGTTCGGCATTACAACTGCNAAAAAAATTTGTCGTG TCTGCTGCCTTTGCGAGTGCCATGACACACGCACGACNATGGCAGAGCAGCACGGGGGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1688744: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16887443115514AA952418TENS1338T. cruzi epimastigote normalized cDNA Library


Date: 11:36:29 on Wed 22 Nov 117.