EST 1688751 is a singleton


Sequence

>1688751 (1 EST) Length=269 AGGCACNAGGTTNGTCCTTGTCTTTACTCTCGTGTTCTTCTAAAAAAATTGATTGCCGGCACTTAGTACGGTAACACNTG CCCCCANATCTCATGGTGTTGCAACCGTGTCCCAGCAANACGCGGCTGGCCCGTGCGCTGGTTGATGCCGTCAGCCCTGC ACCAACAACAATCCCGTGATGGACGGACGCATCGCTGACTGCGGGCTTCCCCCGANAATACGGAGCAATTGGCCCTGGCA CCACGGCNAGGTGGCCGGCATCGCNAAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 1688751: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16887513115521AA952425TENS1363T. cruzi epimastigote normalized cDNA Library


Date: 4:48:57 on Sat 25 Nov 117.