EST 1688768 is a singleton


Sequence

>1688768 (1 EST) Length=286 TNGGCCTCTGAGGCCCNTATTCNGCACGAGGCGTCNGCCNACGTGGTGCGACGCTCACTGGTTGGCATTCCTGGAAANAG TCTGCGCCTCAAGGTGGCCGCCTTTGACTTGGATGACACACTCATCGTGCCGCGGAGCGGGGCGGTCTTTCCTCGTGACN ACCCCAGTGACTGGAANTGGCTGCTGCCGGTGGTGCCGCAGTACTTACGGCTGCTGTACGACAAGGGCTTCATGGTTGTC ATCTTGAGCAATCAGTCCGGGATTGGGGGAAAGGGGTGGAATGTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1688768: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16887683115538AA952442TENS1380T. cruzi epimastigote normalized cDNA Library


Date: 15:19:27 on Fri 24 Nov 117.