EST 1688776 is a singleton


Sequence

>1688776 (1 EST) Length=276 AANTCGGCACGAGGGTGTCGATCAGGTGAAAANATTGTTCGCTCTGAGCTTCATTACCAGCTGGTTCCACCCCTTGTTCA GTGGCAAGGTCTCGCGCACCTCCTTCTCCGAAGAAAGGGGTGACGAGCCAACCAACTGGCCATCCAGCCACATTGCATAG CCCCCATGAAAAATGACACGCGCCGTCGCCTCCATCGACTCCGTGGCATACAACACAACAAACCAATACTGATTGGAATT TCCACCAAAAGGGCGGTGACCCCANATGCCATCTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1688776: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16887763115546AA952450TENS1388T. cruzi epimastigote normalized cDNA Library


Date: 23:52:6 on Sat 18 Nov 117.