EST 1688787 is a singleton


Sequence

>1688787 (1 EST) Length=275 NAATCGGCACNAGGCCACAGCTTTTACTTGCCCCTGTGCTTGGGTGGGGTCCAACATTAAAACGCGCAGGTCTTACGGCG GAGGATATTGATCTCTTTGAAATTCATGAGGCGTTTGCTGCGCAGGTGCTTGCAACTATCAAGTGTCTACAATCTCCGGA ATTTTTTGAAAAATACACCGGTTCGAGGGATGTTGTGCTGAGGGAAAAATTTGATTTTTCCAAACTGAATGTTAATGGAG GAGCTATGGCGCTCGGTCATCCTTTTGCAGCCACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1688787: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16887873115557AA952461TENS1399T. cruzi epimastigote normalized cDNA Library


Date: 10:53:44 on Tue 21 Nov 117.