EST 1688790 is a singleton


Sequence

>1688790 (1 EST) Length=201 ATTCGGCACGAGGGTTTCTGTACTATATTGTGCTAATTAATCATGGCTGGGAATAAAGCTCATCCCATCAAACGGGATTG GTACTGGAATCACAATGACCGCTTTGANATTTGGCATATTCTTGACTGGCCTTCTGTTCGTCGTGGGCGCCAGATCTTCA CAGAGGTCTTTGACTCCATNTCATCCTTTGGGNCGNATGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1688790: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16887903115560AA952464TENS1402T. cruzi epimastigote normalized cDNA Library


Date: 21:8:33 on Fri 24 Nov 117.