EST 1688802 is a singleton


Sequence

>1688802 (1 EST) Length=282 CNTTGNCCCTAATCGGCCGAGGAACCGTCACNCCTTTTCTGGANAGTGTGCTCCCCTTTTTTTTTGTTTTCCTTTCATCT CAAGGCAGGGCGGGATTGGGCAGCACCGTCCCACNAAATTCCTTGCGCACATACACACTCTCATGTCACTGTCTTTTCCG AATTCGGGAGTAAAACCCAAATTTCTGCTGCTCTCTGCACTGGCGCAAGTATTTTTATTATTAACTGACGCCATTTTGTC CGGCGTGTCACTTTGATTTGATTGTGTGGGGTCGCTCGTCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 1688802: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16888023115572AA952476TENS1414T. cruzi epimastigote normalized cDNA Library


Date: 4:24:48 on Wed 22 Nov 117.