EST 1688893 is a singleton


Sequence

>1688893 (1 EST) Length=309 TNTTTGGCCTCTNAGGCCTAGAATCGGCACGAGGAGACTTTCCCATCATCNCNTGTNTACACNCCTTTCTTGATGCGATT GGGACNAGGGGAAACCACCGTGCTCTAATCATGANTAAAAANTAAAGGAAATGTNCTCCAATGGAGGCGGGGTCGTGCCA GTAACTGTTTCTCTGAAGGACAGGAACGGCTGCCTCTGCCTCCGTAATTGGTGCATGCGGCTTTATCTTTTACACTTTTG CTTGTTTTTGTGACTTTGCTTTCCNNTCNTTTTTTTTGTGTGTGTGTGCGTCATTGCNAAAATGTGGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1688893: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16888933115663AA952567TENS1751T. cruzi epimastigote normalized cDNA Library


Date: 23:18:21 on Sun 19 Nov 117.