EST 1688900 is a singleton


Sequence

>1688900 (1 EST) Length=272 AATCGGCACGAGGGTAGACATTAGGAGGGGCACTGTTGCTGGTGACGGGGAAAGGGATGTCNTGGTTCTGATTCACGGCT TTGCTGGCGGACTGGCGTGCTGGGCGCAAAATTGGGAATTTTTCTCGGCAGAATACNANCTGTACNCCATANACCTGCCG GGCTTTGGGAAAAATGAGCGGCCGTGTGTGAAGGTGAGCTCACTGGAAGGTTCNATGCAGTTTATCTGCGGCTACATGGA GCGGTGGCTCTGTGAGATNAACTTTGGACGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1688900: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16889003115670AA952574TENS1758T. cruzi epimastigote normalized cDNA Library


Date: 17:45:58 on Tue 21 Nov 117.