EST 1688939 is a singleton


Sequence

>1688939 (1 EST) Length=266 GGCGANGTGTTGGAANTAACACTCCAATGCNTGCGTTGAGATNAGTTGTTTTTTTTTTTTTCGCTGGGTTTTTTGTTGTN AATTNAAGGCGTGCGGTACGGGTGAAGGGAGAANNAGAAGGAANAAGAAAAGAANAGGGCNNCATCAACAANTATAACNA CATGAATTCTTATGCGCGTTTCTNCTGTGGAGACCAATCGGGACTGTCNTGGATTGGATGGAATCGTCNCCGCGATAAGC ATTTGTTTTTCGGTAGCCTCTTTGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1688939: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16889393115709AA952613TENS1797T. cruzi epimastigote normalized cDNA Library


Date: 2:47:26 on Fri 24 Nov 117.