EST 1688954 is a singleton


Sequence

>1688954 (1 EST) Length=296 TTTGGCCTCNGNGGCCCTTATTCNGCACGAGGGACGTGGAAATGGATGAGGATGCCATAGCATTGCTTACTATGCTTGGT AAGAGCACATCATTGCGATATGTCCTCCANCTCATTACAACGGCAAATTTGGTTGCCCAGAAGCGTCGGGCCTCTACGGT GTCTATTCACGACATCAAAAAGGTGTACTCTCTTTTCATTGACCTGCGTCGCANCGTGGAGCTTCTGCGGGAACACGAGA AGGACTTTCTTTTTGGGGAGGCGGATGAAAATCTTGAGCCGGGCCACCGTACAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1688954: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16889543115724AA952628TENS1812T. cruzi epimastigote normalized cDNA Library


Date: 9:56:25 on Wed 22 Nov 117.