EST 1688965 is a singleton


Sequence

>1688965 (1 EST) Length=280 ANTCGGCACGAGGGCAGACTTTGGCCTCTCCAGCCACAAGACCCCGCCGCAAGGGTGGGAATCCAAAAGGAGGTTACTGG GATGGTAAAAATAAAAAATAAAAACATTATTCTTGACGTTCTCAGTTCCTTTGCTTGCTTTCATCGCGGTCTTCCAAAAN AATTTATGCGGTAGCAANAAGTANTACAGAAATATATCTTTTTCTTTATTGGGATCTTGTGAAAAGGATGTTCGCGGGGG AAGCTGGTCACCTAAATGAATATGTCCTGATAAANTGGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1688965: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16889653115735AA952639TENS1823T. cruzi epimastigote normalized cDNA Library


Date: 14:23:4 on Sat 18 Nov 117.