EST 1688980 is a singleton


Sequence

>1688980 (1 EST) Length=277 AAATCGGCACNAGGATGGTTTACATGCGTGTAGGTAGACATGTGCGGCGGCTTTTGAGTGCGGTGGCCANACGGGATTTC GGCACGGGAGGGACGCAATGCTCTCAAACAACACGGCTAGTCAAGGTCACGGAATCGCCAATAAAAGATGTCAANATTAT TGCCATGAAAAATCCTGCGGCGAACATTCTTTCANCATCTCTTATGANCGATCTTTTGGATGCAATCAGTGAGCTCTGCA ACCCCGAGAAGGATGCCTGCCGGGGCATCGTTTTGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1688980: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16889803115750AA952654TENS1838T. cruzi epimastigote normalized cDNA Library


Date: 9:41:8 on Fri 24 Nov 117.