EST 1688986 is a singleton


Sequence

>1688986 (1 EST) Length=277 TANTCGGCACGAGGGCTGATGGGAGTTGTCATGACNTTNCTTGGGATGGAGCAGAATGACGCGGATGGTTCGTGGGTTCC GCAAATTTACTGCGTAAATCCGGCAGGATGGTGCGGCAGTTACCACGCATGTGCCATCGGCAAAAAGCAGATTGAGGCGA ATGCATTCCTGGAGAANAAGCAGAAAAATGCTCCGTTTCACACACTCTCTCAAAAGGATGCCGCCATGATCGCTCTCGCA GCCCTTCAGAGTGCCCTTGGTGCCTCTCTAAAGGCGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1688986: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16889863115756AA952660TENS1844T. cruzi epimastigote normalized cDNA Library


Date: 11:30:19 on Fri 24 Nov 117.