EST 1688988 is a singleton


Sequence

>1688988 (1 EST) Length=265 TATTCNGCACGAGGTGCGACCGCGGCCACATTACAAAGCCACCGAGACAAAGGCTCAGAAGGGACTGGGGAAGATACAAA AGCAACGAANATTAACCGCCAACACAACTGATACGACNAANCCTGGCGACAGTGACGGCAGCACCGCGGCCTCCCACACC ACCTCCCCTCTTTTGCTTCTTCTTTTTGCGTGTGCGGCTGCTGCTGCGGTGGTGGCCGCGTGAGAGTGAGGGAGANAGAG CCGTGCACCGCCCGCACACACACTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 1688988: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16889883115758AA952662TENS1846T. cruzi epimastigote normalized cDNA Library


Date: 15:18:32 on Thu 23 Nov 117.