EST 1688990 is a singleton


Sequence

>1688990 (1 EST) Length=275 TTCNGCACGAGGCGCATCCCGGATGTGCANAAAAATCGTTTCAGGAGACATCCGCGATAAAGGACGCGAAGCGACGGCTG AAGCAGCGCTGCGAGGACNACCTGAAGAACCTGCACGACGCGATCCANAAGGCGGACATGGAGGACGCGGAGGCGATGAA GCGCTTTGCGACGCNGAAGGAGAAGTCGGAAAAGTTCNTCCAGGAGAACCTCGACAGGCAGGACGAGGCGTGGCGCCNCA TCCAGGAGCTCGAGCGTGTCCTGCATCGTCTGGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1688990: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16889903115760AA952664TENS1848T. cruzi epimastigote normalized cDNA Library


Date: 13:20:51 on Wed 22 Nov 117.