EST 1689006 is a singleton


Sequence

>1689006 (1 EST) Length=269 TANTCGGCACGAGGGCGCGAAAGCCGGCCCGCGCGGGTTTGAGCTAAAACNTGGCGATTATTTTGGCGAAACGTACGGCG ATGTGTTGTTCAGTCCGGGTCTGTTGGAAAANGCGGTGCGGGGGGTTGTGTACTGCATACCGCTCAGCCACTGTCGCTTT CTCTGCGACGCATGGGCGGGAAGAGTTGAGGCTTATTATCCGCTACTTCGCCANAGTGCTTTGCTGCAGGCATTAAATGT CTGGATGCGGCTTCGAATGTGCTGCTGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1689006: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16890063115776AA952680TENS1864T. cruzi epimastigote normalized cDNA Library


Date: 3:51:54 on Sun 19 Nov 117.