EST 1689011 is a singleton


Sequence

>1689011 (1 EST) Length=279 TCAAGCACGAGGATTGCCTNTGGATTTTNATTGGCTTCATTCTGGGCGACNATAGAAAAAAAACNCAGGTGTGGGGAGAA GGGGCGATNAATAACAACCAGGCGGCACNTTACGGTGCCGGGATTCTGCCGGGAGTGCACATNACATACCCCGCGTCGGC GGCGGCTGCAGCTGGGGCGCCCAATCCGTACCAAAGCATGCGAGGGGCGTACCCGGTCNCCACAACGGCATTTGTGACCC NACANCAACAAATNATANCCCAACAACAACAACAACAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1689011: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16890113115781AA952685TENS1869T. cruzi epimastigote normalized cDNA Library


Date: 6:24:47 on Tue 16 Jan 118.