EST 1689029 is a singleton


Sequence

>1689029 (1 EST) Length=302 ATTAAAGGAACTGGAAGGCGGTGTCACCAGGATTCCGATGGAGTACGGGGTGCTGTACCTACCGGCGGTTGAAAACTTTC CGCTGGTGGACGGCTTTTNCTTTGTGAATTCGCCGCGGAANACGCTGGTTGGGCTGCAGATGACTACNGCGAGTGCGCNC CACACGATAANCAGCACCGTGAAGCAGTTCACTGANCGCCTATCGGCATNTTTTNATGATTGGGAGGAATTATCCCGAGA CATGTCTTGGGAGATNATTTATATACCGCACNAAATCTCNTNAAGATAACAAAATGGCNNAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1689029: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16890293115799AA952703TENS1887T. cruzi epimastigote normalized cDNA Library


Date: 12:54:27 on Sun 19 Nov 117.