EST 1689043 is a singleton


Sequence

>1689043 (1 EST) Length=293 TNTGGCCTCGNAGGCCACCCAATCGGCACNAGGTTTCTGTACTATATTGCANANAGGATGCACCCACGTGCTTCAGGGCA GGGTGTATTTCCACGCTATGGTGGTGGGTGGATGCATCAGTTTGGTCATGTGTATGCCCTCCAACAGGAATTACTAAACC CGCAGGCCAGCAATTGGTTTCGGGCGGTTGAACTTTGGCACACGGCGCGTCACNAAGGAGTTGCGCTCAATTCTGCTCAT TACACATCCATTCTTAGGCAGTGCGTGCAGCCGAAAGCGTGGGAAGCCTCACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1689043: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16890433115813AA952717TENS1901T. cruzi epimastigote normalized cDNA Library


Date: 19:29:31 on Sun 19 Nov 117.