EST 1689046 is a singleton


Sequence

>1689046 (1 EST) Length=261 ATTCGGCACGAGGGAATGATATCTTTGCGCGTTTCTGGTCTCAGCNAAAAATGGGTCATGGAGTGGTTCCGCAGGAGGAG GATTGTGTCTACGGACGGCAGCAAGCTACTCTCACCGCGCGCAGAAAAGCCAAAGGAGGAATGTTCTACTGGGAGCTGAC GGCCACCGAACCGTCGCGGCGACGGGGACGCGGCGAAGAGCGACTAAACCAGAGTAGTGGACTGCTTGTAATGTAGGAGG CGTCACCCGCCGTGCATGTNT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1689046: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16890463115816AA952720TENS1904T. cruzi epimastigote normalized cDNA Library


Date: 9:58:9 on Fri 24 Nov 117.