EST 1689055 is a singleton


Sequence

>1689055 (1 EST) Length=241 TTTGGCCTCNGAGGCGCCNATTCGGCACGAGGAAAGGAAGNACNAAAAGGAAGAACCAGTTGCTTTTGTGTTCTGTTTTT TTTTTTTTTATATATAATTATTTTATACTTTTTCTGCATGCACGCCAAATTGCTGGGTATCTCCACCCCTGAAAAGGGGC GACCGCAGGANATGGAAATGTACNTTCCTGATGAGGAGGTTGACTGGACNAGCGATGCNTACAACCGGCTATATGGCGAG C


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1689055: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16890553115825AA952729TENS1913T. cruzi epimastigote normalized cDNA Library


Date: 20:36:43 on Thu 23 Nov 117.