EST 1689061 is a singleton


Sequence

>1689061 (1 EST) Length=290 TGGCCTCTGAGGCCACAATTCGGCACNAGGGTTTGGACGGAACGGAGTCAAAAATTACAGCAGAACGTTCATCCATAGAC CTTGACNATGTGAGCTTCATTCAGCTCGGGTGCTTCAGCAAAGTCTTCAAACGCCACCCCGTCGCATCGACTGACCCCNG TTTCTACCGCAGCTTTACTTTGGGGCTTAAAAGCGGTGGCCGCACTGTCGACATTGTCGCCGGCTCCCTGCCTGACTTTG AGGCGTGGATTGTTGGCTTGTCCAACTTGGTGCGCGTGGACCCCGTGTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1689061: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16890613115831AA952735TENS1919T. cruzi epimastigote normalized cDNA Library


Date: 9:7:16 on Sat 18 Nov 117.