EST 1689064 is a singleton


Sequence

>1689064 (1 EST) Length=257 TTTGGCCTCGGAGGCNCCCAATCGGCANNAGGGAATATTTGGTNTTGGGTTTCTCACAACAACTGCGATGTACTTCACCA TAGGCCATGATCGCTTCATGCACACGCTGTTTGGCTATGANTCGGANATGCACTATGAGGCTCGTGTAAATCCCGACGCA AGCGTCCTCATTGGTGATACATTACTGGACAAAAATCGCGGCTGGAAGTCCCCGCTGCGTGAATTGGAGATGCCACTGCA TCCTAAGCGTCAGTTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1689064: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16890643115834AA952738TENS1922T. cruzi epimastigote normalized cDNA Library


Date: 8:29:31 on Wed 22 Nov 117.