EST 1689075 is a singleton


Sequence

>1689075 (1 EST) Length=279 CTCGGAGGNGGCCAATCGGCANGAGGGACCGTCAAACNTCATTGAAGCGCCGCATCGCACCAATTGACTGAGTTATTANA AAAACGCAAGACGGTGCCTCATGTACATTGCCGTTGTACGTGGGAAGTTACATCGCTGGAGGGCGGCGTGAACTTCCGTC ATTCTTTCCGGGTTTTCCGGAAGTGACACGGTAAAGGTGACAATAAGCACATTTGTAAGTACAAAGGCAACGTCTTCAAT CCGTGACCCGTCCAAACCCGTCGCATTCACAACATCCGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1689075: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16890753115845AA952749TENS1933T. cruzi epimastigote normalized cDNA Library


Date: 18:14:43 on Fri 17 Nov 117.