EST 1689101 is a singleton


Sequence

>1689101 (1 EST) Length=121 GTGCAATCTACTGCCTTATTAGTCTACTAAGACTTAGACCACTTGATTTATATATTTATATATATGCAACCTATACACAG AGAGGGGTTTCTTATTAGTGCCTGTTGAACGACACGTCACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1689101: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16891013116470AA952764SMTBADA000673SKSchistosoma Lambda Zap II


Date: 21:37:3 on Fri 24 Nov 117.