EST 1689103 is a singleton


Sequence

>1689103 (1 EST) Length=115 CTGCAGTTTTATTGCATAGTTATAGTATCCAAAGCTCTTGGATATAAAAGGAAACGACACGGTTAGAAATAAAAGGTATT TTCATCTACGTGTTTGGATGTTATTTTCCTGCAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1689103: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16891033116472AA952766SMTBADA000675SKSchistosoma Lambda Zap II


Date: 10:59:4 on Tue 21 Nov 117.