EST 1689105 is a singleton


Sequence

>1689105 (1 EST) Length=137 ACGCAGCTCCTGTTTCTGTTAATAGTCATATGTCATGTGAACCATTAAGCAATACTGAAAATTTACCAGATAATCCTGTA TTTTTGGATAACAATGACTTATCGCCTAAATCATCATTATACTCCTCAAATCAAAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1689105: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16891053116474AA952768SMTBADA000703SKSchistosoma Lambda Zap II


Date: 7:23:8 on Mon 20 Nov 117.