EST 1689106 is a singleton


Sequence

>1689106 (1 EST) Length=105 CGTTACCTTGTGGTTAAGATGTCACAAATGCATGCAGTAGCTGATGATTTCGATGCATCTGAATTGAAATTCTCTAAAGA TTTTGAGAACAGTCCGATACATTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1689106: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16891063116475AA952769SMTBADA000704SKSchistosoma Lambda Zap II


Date: 1:38:15 on Sun 19 Nov 117.