EST 1689117 is a singleton


Sequence

>1689117 (1 EST) Length=221 ACCCAGAAGCTCTTTCACAAGTATCTTAGTCAACAAATCCTATTTCTGTTGGTGAATTAAAACGATTAGCCTATTCATTA GGTCCCAAACAAGGACCAAGTTTACCTCCAACACAAGACCAAAGAGGAAATATTATTGATCAAACAAGGATGTATTCACG TTCGAATCGAAACGACATGTAAACACCTTCAGAACTGAAGACAATAATGTGACAGTCTATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1689117: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16891173116486AA952780SMTBCEA000059SKSchistosoma Lambda Zap II cercariae


Date: 22:39:46 on Tue 21 Nov 117.