EST 1689123 is a singleton


Sequence

>1689123 (1 EST) Length=163 TTTCTGGTGTATTATAATAAGTTACCTGGTTTGGAGTTTAGGGTCCGATTAGTAGTCGGTCGGGTTAGTAGGTTTTAGGG TTAGTTTTCAGTTGGGTTTGGGGTCTTTAGAGTCATAATCGTAGTAGGGGTTATTATATTTTGCTGGTTTGGAGTTATTA GGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1689123: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16891233116492AA952786SMTBCEA000108SKSchistosoma Lambda Zap II cercariae


Date: 21:17:42 on Sun 19 Nov 117.